March 7, 2021
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Whereas the harm to chromosomes and genes induced by high-dose radiation (HDR) has been nicely researched in lots of organisms, the results of low-dose radiation (LDR), outlined as a radiation dose of ≤100 mSv, are nonetheless being debated. Latest analysis has urged that the organic results of LDR differ from these noticed in HDR. To detect the impact of LDR on genes, we chosen a gene of Drosophila melanogaster, often known as the a number of wing hair (mwh) gene. The hatched heterozygous larvae with genotype mwh/+ have been irradiated by γ-rays of a 60Co supply. After eclosion, the wing hairs of the heterozygous flies have been noticed. The realm of just one or two mwh cells (small spot) and that of greater than three mwh cells (giant spot) have been counted.

The ratio of the 2 sorts of spots have been in contrast between teams irradiated by totally different doses together with a non-irradiated management group. For the small spot in females, the eruption frequency elevated within the teams irradiated with 20-75 mGy, indicating hypersensitivity (HRS) to LDR, whereas within the teams irradiated with 200 and 300 mGy, the frequency decreased, indicating induced radioresistance (IRR), whereas in males, 50 and 100 mGy conferred HRS and 75 and 200 mGy conferred IRR. For the massive spot in females, 75 mGy conferred HRS and 100-800 mGy conferred IRR. In conclusion, HRS and IRR to LDR was present in Drosophila wing cells by delimiting the dose of γ-rays finely, besides within the male giant spot.

Though lead related to intelligence decline in kids has lengthy been reported, research combining intelligence willpower, molecular mechanisms exploration, and biomarker display are fairly uncommon. On this examine, primarily based on 333 kids aged 9-11, we decided the position of DNA methylation (DNAm) within the relationship of lead publicity with kids’s intelligence. DNAm was measured from kids’s blood DNA specimens, and mediation evaluation was carried out to determine DNAm biomarkers mediating the lead-intelligence relationship.

Dynamic Stereoselection of Peptide Helicates and Their Selective Labeling of DNA Replication Foci in Cells

Though largely missed in peptide engineering, coordination chemistry affords a brand new set of interactions that opens unexplored design alternatives for growing complicated molecular buildings. On this context, we report new synthetic peptide ligands that fold into chiral helicates within the presence of labile steel ions comparable to Fe(II) and Co(II). Heterochiral β flip selling sequences encode the stereoselective folding of the peptide ligands and outline the physicochemical properties of their corresponding steel complexes. CD and NMR spectroscopy together with computational strategies allowed us to determine and decide the construction of two isochiral ΛΛ-helicates, folded as topological isomers.
Lastly, along with the in vitro characterization of their selective binding to DNA three-way junctions, cell microscopy experiments demonstrated {that a} rhodamine-labeled Fe(II) helicate was internalized and selectively stains DNA replication factories in practical cells. As well as, blood lead ranges (BLLs) decrease than 100 μg/L nonetheless adversely affected kids’s IQs and DNAm of the 2 fragments. Our knowledge means that DNAm mediates lead-associated cognitive delay in kids and blood lead reference worth for school-aged kids (100 μg/L) ought to be revised, and the candidate biomarkers can be utilized in associated neurological ailments in future.
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Carbon nanotube transmembrane channel formation and single-stranded DNA spontaneous internalization: a dissipative particle dynamics examine

Single-walled carbon nanotube (SWCNT) transmembrane channel formation in a pure 1,2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMPC) bilayer, and the spontaneous internalization of single-stranded DNA (ssDNA) into the shaped pore have been simulated. A mix of computational strategies, Dissipative Particle Dynamics-Monte Carlo hybrid simulations and quantum mechanical calculations on the hybrid-DFT degree, was used as a brand new proposal to carry out DPD simulations granting particular chemical identification to the mannequin particles.
The simulated transmembrane channels confirmed that, within the case of pristine SWCNTs and upon growing the nanotube size, the next tilt angle with respect to the bilayer regular is noticed and extra time is required for the nanotube to stabilize. Alternatively, for SWCNTs with polar rims an virtually perpendicular orientation is most well-liked with lower than 15° of tilt with respect to the bilayer regular as soon as the nanotubes have pierced each monolayers. These findings are supported by experimental observations the place CNTs of common inside diameters of 1.51 ± 0.21 nm and lengths within the 5-15 nm vary have been inserted in DOPC membranes. Furthermore, the narrower the SWCNTs, the slower the spontaneous internalization of ssDNA turns into, and ssDNA ends hydrophobically trapped inside the factitious pore.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus

C1534274 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus

C1534274-Cy 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Cervix

C1234275 40 reactions
EUR 376
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Corpus

C1234276-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Fundus

C1234278-10 10 reactions
EUR 231
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix

C1534275 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus: Cervix

C1534275-Cy 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus

C1534276 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus

C1534278 40 reactions
EUR 540
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-48T 48T
EUR 441
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-96T 96T
EUR 570
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-48T 48T
EUR 527
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-96T 96T
EUR 688
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-48T 48T
EUR 549
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-96T 96T
EUR 718
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-48Tests 48 Tests
EUR 436

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-96Tests 96 Tests
EUR 601

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-48Tests 48 Tests
EUR 533

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-96Tests 96 Tests
EUR 740

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-48Tests 48 Tests
EUR 557

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-96Tests 96 Tests
EUR 775

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-48Tests 48 Tests
EUR 455

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-96Tests 96 Tests
EUR 629

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-48Tests 48 Tests
EUR 557

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-96Tests 96 Tests
EUR 774

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-48Tests 48 Tests
EUR 583

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-96Tests 96 Tests
EUR 811

Human Uterus Tumor lysate

HTL-1384 1 mg
EUR 773

Total RNA from Human Adult Normal Tissue: Uterus: Cervix of uterus

R1234275-50 50 ug
EUR 178
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Human Adult Normal Tissue: Uterus: Corpus of Uterus

R1234276-10 10 ug
EUR 194
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Lupus: Uterus

R1236274Lup-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT/ Rat CAT ELISA Kit

ELA-E0242r 96 Tests
EUR 886

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Uterus: Cervix of uterus

R1234275-P 50 ug
EUR 328
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT siRNA

20-abx900807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910366
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT Antibody

36312-100ul 100ul
EUR 252

Cat IgM

31C-CH0213 1 mg
EUR 392
Description: Purified Cat IgM

CAT antibody

10R-3584 100 ul
EUR 726
Description: Mouse monoclonal CAT antibody

CAT antibody

10R-3585 100 ul
EUR 691
Description: Mouse monoclonal CAT antibody

CAT antibody

20C-CR1111RP 500 ul
EUR 262
Description: Rabbit polyclonal CAT antibody

CAT antibody

70R-16187 50 ul
EUR 435
Description: Rabbit polyclonal CAT antibody

CAT Antibody

1-CSB-PA942303
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA004563GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody

1-CSB-PA004980
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT Antibody

1-CSB-PA599838
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA070043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

pOTB7-CAT

PVT18217 2 ug
EUR 231

pCas9- CAT

PVT11001 2 ug
EUR 301

Frozen Tissue Section - Human Tumor: Uterus

T1235274 5 slides
EUR 338
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Adult Uterus (Normal) Whole tissue lysate

HAL-1317 1 mg
EUR 524

FFPE Genomic DNA - Human Tumor Tissue: Uterus

D2235274 2 ug
EUR 821
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Monkey (Rhesus) Normal Uterus Whole tissue lysate

MRL-1332 1 mg
EUR 773

Total Protein from Human Tumor Tissue: Uterus

P1235274 1 mg
EUR 320
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Monkey (Cyno.) Normal Uterus Whole tissue lysate

MCL-1222 1 mg
EUR 773

Membrane Protein from Human Tumor Tissue: Uterus

P3235274 0.1 mg
EUR 408
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Human Tumor Tissue: Uterus

R1235274-50 50 ug
EUR 351
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Frozen Tissue Section - Human Adult Normal: Uterus

T1234274 5 slides
EUR 349
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Adult Normal: Uterus

T2234274 5 slides
EUR 211
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Human Uterus Cervix Tumor

T2235275 5 slides
EUR 257
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

PKA CAT Antibody

AF5450 200ul
EUR 304
Description: PKA CAT Antibody detects endogenous levels of total PKA CAT.

CAT Conjugated Antibody

C36312 100ul
EUR 397

PKA CAT Antibody

AF7746 200ul
EUR 376
Description: PKA CAT Antibody detects endogenous levels of PKA CAT.

CAT cloning plasmid

CSB-CL004563HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.

Cat Uromodulin Enzyme

20-abx073947
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0.1 mg
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125619
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx125620
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx111432
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx132110
  • EUR 272.00
  • EUR 592.00
  • EUR 314.00
  • EUR 154.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx132122
  • EUR 300.00
  • EUR 718.00
  • EUR 384.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx141181
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

abx147539-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx148940
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx100146
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100147
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100148
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx100149
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100150
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

20-abx100151
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Catalase (CAT) Antibody

abx034033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx034033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx025488-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx004037
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PKA CAT Antibody

ABF5450 100 ug
EUR 438

Catalase (CAT) Antibody

20-abx175722
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Catalase (CAT) Antibody

20-abx323535
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx326479
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

20-abx214177
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx430824-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Catalase (CAT) Antibody

20-abx242079
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Catalase (CAT) Antibody

abx231301-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Catalase (CAT) Antibody

20-abx171619
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

CAT Rabbit pAb

A11777-100ul 100 ul
EUR 308

CAT Rabbit pAb

A11777-200ul 200 ul
EUR 459

CAT Rabbit pAb

A11777-20ul 20 ul
EUR 183

CAT Rabbit pAb

A11777-50ul 50 ul
EUR 223
A dependence on the nucleotide content material is discovered indicating that the upper the presence of adenine and thymine within the ssDNA chains the slower the internalization turns into, in settlement with the experimental and predicted solvation tendency in water for nucleic acid bases.

Leave a Reply

Your email address will not be published. Required fields are marked *