November 30, 2022
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Whereas the harm to chromosomes and genes induced by high-dose radiation (HDR) has been nicely researched in lots of organisms, the results of low-dose radiation (LDR), outlined as a radiation dose of ≤100 mSv, are nonetheless being debated. Latest analysis has urged that the organic results of LDR differ from these noticed in HDR. To detect the impact of LDR on genes, we chosen a gene of Drosophila melanogaster, often known as the a number of wing hair (mwh) gene. The hatched heterozygous larvae with genotype mwh/+ have been irradiated by γ-rays of a 60Co supply. After eclosion, the wing hairs of the heterozygous flies have been noticed. The realm of just one or two mwh cells (small spot) and that of greater than three mwh cells (giant spot) have been counted.

The ratio of the 2 sorts of spots have been in contrast between teams irradiated by totally different doses together with a non-irradiated management group. For the small spot in females, the eruption frequency elevated within the teams irradiated with 20-75 mGy, indicating hypersensitivity (HRS) to LDR, whereas within the teams irradiated with 200 and 300 mGy, the frequency decreased, indicating induced radioresistance (IRR), whereas in males, 50 and 100 mGy conferred HRS and 75 and 200 mGy conferred IRR. For the massive spot in females, 75 mGy conferred HRS and 100-800 mGy conferred IRR. In conclusion, HRS and IRR to LDR was present in Drosophila wing cells by delimiting the dose of γ-rays finely, besides within the male giant spot.

Though lead related to intelligence decline in kids has lengthy been reported, research combining intelligence willpower, molecular mechanisms exploration, and biomarker display are fairly uncommon. On this examine, primarily based on 333 kids aged 9-11, we decided the position of DNA methylation (DNAm) within the relationship of lead publicity with kids’s intelligence. DNAm was measured from kids’s blood DNA specimens, and mediation evaluation was carried out to determine DNAm biomarkers mediating the lead-intelligence relationship.

Dynamic Stereoselection of Peptide Helicates and Their Selective Labeling of DNA Replication Foci in Cells

Though largely missed in peptide engineering, coordination chemistry affords a brand new set of interactions that opens unexplored design alternatives for growing complicated molecular buildings. On this context, we report new synthetic peptide ligands that fold into chiral helicates within the presence of labile steel ions comparable to Fe(II) and Co(II). Heterochiral β flip selling sequences encode the stereoselective folding of the peptide ligands and outline the physicochemical properties of their corresponding steel complexes. CD and NMR spectroscopy together with computational strategies allowed us to determine and decide the construction of two isochiral ΛΛ-helicates, folded as topological isomers.
Lastly, along with the in vitro characterization of their selective binding to DNA three-way junctions, cell microscopy experiments demonstrated {that a} rhodamine-labeled Fe(II) helicate was internalized and selectively stains DNA replication factories in practical cells. As well as, blood lead ranges (BLLs) decrease than 100 μg/L nonetheless adversely affected kids’s IQs and DNAm of the 2 fragments. Our knowledge means that DNAm mediates lead-associated cognitive delay in kids and blood lead reference worth for school-aged kids (100 μg/L) ought to be revised, and the candidate biomarkers can be utilized in associated neurological ailments in future.
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster
Biological effects of low-dose γ-ray irradiation on chromosomes and DNA of Drosophila melanogaster

Carbon nanotube transmembrane channel formation and single-stranded DNA spontaneous internalization: a dissipative particle dynamics examine

Single-walled carbon nanotube (SWCNT) transmembrane channel formation in a pure 1,2-dimyristoyl-sn-glycero-3-phosphorylcholine (DMPC) bilayer, and the spontaneous internalization of single-stranded DNA (ssDNA) into the shaped pore have been simulated. A mix of computational strategies, Dissipative Particle Dynamics-Monte Carlo hybrid simulations and quantum mechanical calculations on the hybrid-DFT degree, was used as a brand new proposal to carry out DPD simulations granting particular chemical identification to the mannequin particles.
The simulated transmembrane channels confirmed that, within the case of pristine SWCNTs and upon growing the nanotube size, the next tilt angle with respect to the bilayer regular is noticed and extra time is required for the nanotube to stabilize. Alternatively, for SWCNTs with polar rims an virtually perpendicular orientation is most well-liked with lower than 15° of tilt with respect to the bilayer regular as soon as the nanotubes have pierced each monolayers. These findings are supported by experimental observations the place CNTs of common inside diameters of 1.51 ± 0.21 nm and lengths within the 5-15 nm vary have been inserted in DOPC membranes. Furthermore, the narrower the SWCNTs, the slower the spontaneous internalization of ssDNA turns into, and ssDNA ends hydrophobically trapped inside the factitious pore.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus

C1534274 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus

C1534274-Cy 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Cervix

C1234275 40 reactions
EUR 451.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Corpus

C1234276-10 10 reactions
EUR 277.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Adult Normal Tissue: Uterus: Fundus

C1234278-10 10 reactions
EUR 277.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Cervix

C1534275 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Cynomolgus) Normal Tissue: Uterus: Cervix

C1534275-Cy 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Corpus

C1534276 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Monkey (Rhesus) Normal Tissue: Uterus: Fundus

C1534278 40 reactions
EUR 648
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-48T 48T
EUR 529.2
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

DLR-CAT-Hu-96T 96T
EUR 684
  • Should the Human Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-48T 48T
EUR 632.4
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Catalase (CAT) ELISA Kit

DLR-CAT-Mu-96T 96T
EUR 825.6
  • Should the Mouse Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-48T 48T
EUR 658.8
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Catalase (CAT) ELISA Kit

DLR-CAT-Ra-96T 96T
EUR 861.6
  • Should the Rat Catalase (CAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catalase (CAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-48Tests 48 Tests
EUR 546

Human Catalase (CAT) ELISA Kit

RDR-CAT-Hu-96Tests 96 Tests
EUR 754.8

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-48Tests 48 Tests
EUR 668.4

Mouse Catalase (CAT) ELISA Kit

RDR-CAT-Mu-96Tests 96 Tests
EUR 928.8

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-48Tests 48 Tests
EUR 699.6

Rat Catalase (CAT) ELISA Kit

RDR-CAT-Ra-96Tests 96 Tests
EUR 973.2

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-48Tests 48 Tests
EUR 523.2

Human Catalase (CAT) ELISA Kit

RD-CAT-Hu-96Tests 96 Tests
EUR 721.2

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-48Tests 48 Tests
EUR 639.6

Mouse Catalase (CAT) ELISA Kit

RD-CAT-Mu-96Tests 96 Tests
EUR 888

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-48Tests 48 Tests
EUR 668.4

Rat Catalase (CAT) ELISA Kit

RD-CAT-Ra-96Tests 96 Tests
EUR 930

Uterus Tumor Lysate

1384 0.1 mg
EUR 304.8
Description: Uterus tumor tissue lysate was prepared by homogenization in lysis buffer (10 mM HEPES pH7.9, 1.5 mM MgCl2, 10 mM KCl, 1 mM ethylenediaminetetraacetic acid, 10% glycerol, 1% NP-40, and a cocktail of protease inhibitors). Tissue and cell debris was removed by centrifugation. The product was boiled for 5 min in 1 x SDS sample buffer (50 mM Tris-HCl pH 6.8, 12.5% glycerol, 1% sodium dodecylsulfate, 0.01% bromophenol blue) containing 50 mM DTT.

Fetal Uterus Lysate

XBL-10431 0.1 mg
EUR 632.4
Description: Fetal human uterus tissue lysate was prepared by homogenization using a proprietary technique. The tissue was frozen in liquid nitrogen immediately after excision and then stored at -70°C. The fetal human uterus tissue total protein is provided in a buffer including HEPES (pH7.9), MgCl2, KCl, EDTA, Sucrose, Glycerol, Sodium deoxycholate, NP-40, and a cocktail of protease inhibitors. For quality control purposes, the uterus tissue pattern on SDS-PAGE gel is shown to be consistent for each lot by visualization with coomassie blue staining. The uterus tissue is then Western analyzed by either GAPDH or β-actin antibody, and the expression level is consistent with each lot.

Uterus Membrane Lysate

XBL-11023 0.1 mg
EUR 619.8
Description: Human uterus tissue membrane protein lysate was prepared by isolating the membrane protein from whole tissue homogenates using a proprietary technique. The human uterus tissue was frozen in liquid nitrogen immediately after excision and then stored at -70°C. The membrane protein is provided in a buffer including HEPES (pH 7.9), MgCl2, KCl, EDTA, Sucrose, Glycerol, sodium deoxycholate, NP-40, and a cocktail of protease inhibitors. For quality control purposes, the isolated uterus tissue membrane protein pattern on SDS-PAGE gel is shown to be consistent for each lot by visualization with coomassie blue staining. The isolated uterus tissue membrane protein is then Western analyzed by either GAPDH or β-actin antibody to confirm there is no signal or very weak signal.

Bovine UTERUS 5 EA*

57153-2 5 EA
EUR 245.04

Uterus Tissue Slide (Normal)

11-401-10um 10 um
EUR 241.8

Uterus Tissue Slide (Normal)

11-401-4um 4 um
EUR 216.6

Uterus Tissue Slide (Benign)

11-402-10um 10 um
EUR 241.8

Uterus Tissue Slide (Benign)

11-402-4um 4 um
EUR 216.6

Uterus Tissue Slide (Adenocarcinoma)

11-404-10um 10 um
EUR 241.8

Uterus Tissue Slide (Adenocarcinoma)

11-404-4um 4 um
EUR 216.6

Uterus Tissue Slide (Abnormal)

11-419-10um 10 um
EUR 241.8

Uterus Tissue Slide (Abnormal)

11-419-4um 4 um
EUR 216.6

Uterus Tissue Slide (Adenomyoma)

11-432-10um 10 um
EUR 241.8

Uterus Tissue Slide (Adenomyoma)

11-432-4um 4 um
EUR 216.6

Human Uterus Tumor lysate

HTL-1384 1 mg
EUR 927.6

Uterus Membrane Tumor Lysate

XBL-11031 0.1 mg
EUR 752.1
Description: Human uterus tissue membrane protein lysate was prepared by isolating the membrane protein from whole tissue homogenates using a proprietary technique. The human uterus tissue was frozen in liquid nitrogen immediately after excision and then stored at -70°C. The membrane protein is provided in a buffer including HEPES (pH 7.9), MgCl2, KCl, EDTA, Sucrose, Glycerol, sodium deoxycholate, NP-40, and a cocktail of protease inhibitors. For quality control purposes, the isolated uterus tissue membrane protein pattern on SDS-PAGE gel is shown to be consistent for each lot by visualization with coomassie blue staining. The isolated uterus tissue membrane protein is then Western analyzed by either GAPDH or β-actin antibody to confirm there is no signal or very weak signal.

Uterus-Corpus Membrane Lysate

XBL-11037 0.1 mg
EUR 619.8
Description: Human uterus-corpus tissue membrane protein lysate was prepared by isolating the membrane protein from whole tissue homogenates using a proprietary technique. The human uterus-corpus tissue was frozen in liquid nitrogen immediately after excision and then stored at -70°C. The membrane protein is provided in a buffer including HEPES (pH 7.9), MgCl2, KCl, EDTA, Sucrose, Glycerol, sodium deoxycholate, NP-40, and a cocktail of protease inhibitors. For quality control purposes, the isolated uterus-corpus tissue membrane protein pattern on SDS-PAGE gel is shown to be consistent for each lot by visualization with coomassie blue staining. The isolated uterus-corpus tissue membrane protein is then Western analyzed by either GAPDH or β-actin antibody to confirm there is no signal or very weak signal.

Uterus-Fundus Membrane Lysate

XBL-11040 0.1 mg
EUR 619.8
Description: Human uterus-fundus tissue membrane protein lysate was prepared by isolating the membrane protein from whole tissue homogenates using a proprietary technique. The human uterus-fundus tissue was frozen in liquid nitrogen immediately after excision and then stored at -70°C. The membrane protein is provided in a buffer including HEPES (pH 7.9), MgCl2, KCl, EDTA, Sucrose, Glycerol, sodium deoxycholate, NP-40, and a cocktail of protease inhibitors. For quality control purposes, the isolated uterus-fundus tissue membrane protein pattern on SDS-PAGE gel is shown to be consistent for each lot by visualization with coomassie blue staining. The isolated uterus-fundus tissue membrane protein is then Western analyzed by either GAPDH or β-actin antibody to confirm there is no signal or very weak signal.

Total RNA from Human Adult Normal Tissue: Uterus: Cervix of uterus

R1234275-50 50 ug
EUR 213.6
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Total RNA from Human Adult Normal Tissue: Uterus: Corpus of Uterus

R1234276-10 10 ug
EUR 232.8
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT/ Rat CAT ELISA Kit

ELA-E0242r 96 Tests
EUR 1063.2

Rabbit UTERUS Y 25 EA*

41253-2 25 EA
EUR 382.07

Uterus Tissue Slide (Endometrioid Adenocarcinoma)

11-405-10um 10 um
EUR 241.8

Uterus Tissue Slide (Endometrioid Adenocarcinoma)

11-405-4um 4 um
EUR 216.6

Total RNA from Lupus: Uterus

R1236274Lup-50 50 ug
EUR 421.2
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

CAT Antibody

1-CSB-PA070043
  • EUR 266.40
  • EUR 234.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

CAT Antibody

1-CSB-PA004563GA01HU
  • EUR 716.40
  • EUR 399.60
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAT Antibody

1-CSB-PA004980
  • EUR 266.40
  • EUR 234.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CAT. Recognizes CAT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CAT siRNA

20-abx910366
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT siRNA

20-abx910367
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAT Antibody

1-CSB-PA599838
  • EUR 380.40
  • EUR 292.80
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CAT Antibody

1-CSB-PA942303
  • EUR 380.40
  • EUR 292.80
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAT. Recognizes CAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

Cat IgM

31C-CH0213 1 mg
EUR 470.4
Description: Purified Cat IgM

CAT antibody

70R-16187 50 ul
EUR 522
Description: Rabbit polyclonal CAT antibody

CAT Antibody

36312-100ul 100ul
EUR 302.4

CAT antibody

20C-CR1111RP 500 ul
EUR 314.4
Description: Rabbit polyclonal CAT antibody

CAT antibody

10R-3584 100 ul
EUR 871.2
Description: Mouse monoclonal CAT antibody

CAT antibody

10R-3585 100 ul
EUR 829.2
Description: Mouse monoclonal CAT antibody

CAT siRNA

20-abx900807
  • EUR 661.20
  • EUR 878.40
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-CAT

PVT18217 2 ug
EUR 277.2

pCas9- CAT

PVT11001 2 ug
EUR 361.2

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 678.00
  • EUR 577.20
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Novo? cDNA Kit

M1165-100
EUR 424.8

Novo? cDNA Kit

M1165-25
EUR 320.4

Evo? cDNA Supermix

M1168-100
EUR 457.2

Evo? cDNA Supermix

M1168-25
EUR 320.4

Novo? cDNA Supermix

M1169-100
EUR 529.2

Novo? cDNA Supermix

M1169-25
EUR 346.8

Total RNA from Human Adult Normal Tissue 5 Donor Pool: Uterus: Cervix of uterus

R1234275-P 50 ug
EUR 393.6
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Uterus Tissue Slide ( Papillary serous Adenocarcinoma)

11-407-10um 10 um
EUR 241.8

Uterus Tissue Slide ( Papillary serous Adenocarcinoma)

11-407-4um 4 um
EUR 216.6

Uterus Tissue Slide (Spindle Cell Tumor)

11-418-10um 10 um
EUR 241.8

Uterus Tissue Slide (Spindle Cell Tumor)

11-418-4um 4 um
EUR 216.6

Frozen Tissue Section - Human Tumor: Uterus

T1235274 5 slides
EUR 405.6
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 745.2
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Catalase (10,000-15,000 U/mg), Bovine Liver

CAT-01 25 mU
EUR 634.8

Catalase (2000-4000 U/mg), Aspergillus Niger

CAT-02 25 mU
EUR 781.2

Catalase (4000-6000 U/mg), Bovine Liver

CAT-03 5 mU
EUR 416.4

Catalase (>40,000 u/mg), Bovine Liver

CAT-04 1 mg
EUR 343.2

CAT Conjugated Antibody

C36312 100ul
EUR 476.4

CAT cloning plasmid

CSB-CL004563HU-10ug 10ug
EUR 451.2
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTG
  • Show more
Description: A cloning plasmid for the CAT gene.

Cat IgG (FITC)

65C-CH0202 1 mg
EUR 272.4
Description: Purified Cat IgG FITC conjugate

Cat IgG (HRP)

65C-CH0203 1 mg
EUR 297.6
Description: Purified Cat IgG HRP conjugate

b-cat antibody

70R-21460 50 ul
EUR 522
Description: Rabbit polyclonal b-cat antibody

CAT Rabbit pAb

A11777-100ul 100 ul
EUR 369.6

CAT Rabbit pAb

A11777-200ul 200 ul
EUR 550.8
A dependence on the nucleotide content material is discovered indicating that the upper the presence of adenine and thymine within the ssDNA chains the slower the internalization turns into, in settlement with the experimental and predicted solvation tendency in water for nucleic acid bases.

Leave a Reply

Your email address will not be published. Required fields are marked *